Sentence examples for using the pairs of from inspiring English sources

Using the pairs of images with opposite phase encoding, the susceptibility-induced off-resonance field was estimated using a method similar to that described in Andersson62 as implemented in FSL's TOPUP tool, and the two images were combined into a single corrected one.

However, since the proposed algorithm I estimates the sensitivity maps reliably using the pairs of lit and unlit frames, it segments the objects correctly.

Permeability of the reservoir B1 was specified according to the results of field well testing using the pairs of values "flow rate pressure" before putting the object into operation out of conservation.

Then, the hypocenter was computed using the method of Chao et al. (2013), which computes the hypocenter location by grid-search method using the pairs of travel time differences of the envelopes in the seismic network.

In addition, an EcoRI restriction site naturally occurring in the region of the gene coding for the PAS/His-kinase portion of bvgS was removed by overlapping PCR using the pairs of primers ΔEcoRI-Up and PAS/HisKin-Lo, and ΔEcoRI-Lo and PAS/HisKin-Up.

Similarly, using the pairs of primers F-COI-2 and R-CYTB and F-12S-2 and R-COI fragments of 7.3 and 5.5 kb, respectively, were obtained.

We constructed the inter-scale co-occurrence matrices by using the pair of the wavelet difference values across the inter-scale subbands.

Using the pairing of NJ with NN allows direct comparison of the reconstructed phylogenetic signal and the reconstructed combination of phylogenetic and tokogenetic signals.

For detecting the presence of an event in the field using the pair of sensors, we investigate two different categories of collaborative detection schemes.

This figure demonstrates that the H2O abundance can be obtained based on the differential absorption technique using the pair of 0.97/1.01 εm channels.

RT-PCR was done using the pair of oligonucleotides: GumDup (5' GCGCGGCCGTGGGATTGCTGAGT 3') and GumDdown (5' TGGCGGCGCTGACGGAAGAACAC 3') under the PCR conditions described previously.