Sentence examples for using the oligonucleotide sequences from inspiring English sources

The genomic fragment was subcloned into a pUC18 vector and site-directed mutagenesis (QuikChange™ Stratagene) was performed to introduce a single G to A mutation in exon 11 using the oligonucleotide sequences 5'-TCTTTTCCAGATGAATTGCCCTGCTGA-3'and 5'-AGCCAGGGCAATTTCATCTGGAAAAGAGA-3'.

A PCR-based screening method using the oligonucleotide sequences 5'-TGATGGGATTGAATGTAGGC-3' and 5'-TTAGAACAAGCTTCACTGTAC-3' (94°C for 1 min followed by cycles of 94°C for 30 sec, 62°C for 30 sec and 72°C for 1 min for 29 cycles) was used to determine the presence of the single loxP site that remains after Cre-mediated recombination of the floxed neomycin resistance cassette within the RIαB allele.

PCR amplification was performed in ChIP fragments using the oligonucleotide sequences described previously.

cDNAs corresponding to the EST sequences were obtained by PCR amplification, and full-length cDNAs were obtained by RACE (Cap Fishing; SeeGene, Seoul, South Korea) using the oligonucleotide sequences as shown in Additional file 13.

Site-directed mutagenesis was carried out on the vector containing sso1450 to mutate active site residue glutamic acid 142 to an alanine using the oligonucleotide sequence 5′-GTTGGATAAGGATGCACCGGCTGCTGCTAG.

QRT-PCR was performed by using the oligonucleotides and sequence parameters described in Table  2 in a medium containing 1X LightCycler 480 SYBR Green I master mix, 0.25 μM of each primer and 20 ng of cDNA.

Plasmids were sequenced using the oligonucleotide primers listed in Table S4, and errors were verified by sequencing related plasmids for comparison.

The amplified product was purified and subjected to automatic sequencing using the 5' oligonucleotide as primer using an ABI Prism 310 DNA sequencer (Applied Biosystems).

For all animals, a PCR fragment of 1138 bp encompassing the mtDNA control region (np 15718-517) wasequenceded using the oligonucleotide 15757for, 5' CCCCAAAGCTGAAGTTCTAT 3', as previously described [9].

Using the long oligonucleotide sequences as a reference, probe clusters were identified where there is a match with complete sequence identity between the long oligonucleotide sequences and short oligonucleotide sequences for the span of the short oligonucleotide sequence for both Affymetrix microarrays (matching probe clusters).

Clone inserts were sequenced using the oligonucleotides listed in the Supporting Information (PCR Primers S1).