Sentence examples for using the indicated probes from inspiring English sources

The indicated mutants were expressed in HEK 293T cells and assayed in a Northern blot using the indicated probes that perfectly matched the mutated miRNAs.

(B ) Southern blotting identified correctly targeted ES clones using the probes indicated in panel E.

Mice were genotyped by Southern blot using the probe indicated in Figure 8A or PCR analysis using the following primers: Rbm44 wt allele-forward, 5'-ACTGCATGGAAAAGGTCAGG; Rbm44 wt allele-reverse, 5'- GGAGTGGCTCCTGCTTACTG; Rbm44 deleted allele-forward, 5'- AACAGTCAGAGCCCCCTTTA; Rbm44 deleted allele-reverse: 5'-ACCATGGAGGCTATGTGTGA.

RT-exoRPA analysis of the infected plants using the primer/probe indicated that the virus could be detected from leaves, stems, petals, pollen, primary roots and secondary roots.

All 251 cases that were negative for ALK by IHC were confirmed to lack ALK rearrangements by FISH studies using the break-apart probe indicating a sensitivity of IHC of 100% in this cohort.

The experimental results indicate the feasibility of detecting Hg2+ accurately using the BSA-GNPs probes.

The average number of probe sets per gene indicates the ability to detect alternative splicing events using the remapped probe sets.

The gray boxes indicate probe 8B used in DNA gel blot analysis, the short vertical black lines are Sac I sites, and the numbers between the Sac I sites indicate the lengths of those fragments detected by probe 8B.

Southern hybridization of genomic DNA of apomictic and sexual plants using the OPF08-600 frasment as probe indicated the presence of two copies of the SCAR sequence in only the apomictic plants.

Accordingly, HPV typing of lesions in the present study was determined by PCR assay and hybridization/wash conditions were then optimized empirically for sensitivity and clean background using the appropriate HPV-type probe as indicated following the PCR.

Band-counting using RFLP probes indicates that more than 90% of all low copy sequences in soybean are present in more than two copies [ 4].