Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
To assess this possibility, a specific measurement only for amino acids using another analytical instrument gas chromatography-mass spectrometry (GC-MS) was performed using the identical samples.
The lack of a robust circadian rhythm in H3K9me3 was not due to errors in processing the ChIP lysates because there is a high-amplitude circadian rhythm in WC-2 binding to the C-box using the identical samples.
Similar(58)
To make the transcriptomics data comparable with previous proteomics data, we used the identical sampling conditions for transcriptomics as our previous proteomic analysis [ 26].
To make the transcriptomics data comparable with previous proteomics data, we used the identical sampling conditions for transcriptomics as our previous proteomics analysis [ 9].
Although we measured these biomarkers using the identical blood samples to directly compare related parameters to obtain mechanistic insights into the metabolism of glycerol LPLs in vivo, the possibility of this sampling difference affecting the data cannot be ruled out.
We checked potential loss of analytes during extraction and clean-up by reextracting the samples using the identical protocol used for the samples.
Our dataset covers a relatively broad spectrum of NSCLC, and we have validated the signatures using independent samples profiled using the identical platform [10].
Individual DNA samples were amplified using the identical primers to those used on pooled DNA templates.
In addition, the RNA samples used for qRT-PCR were not the identical samples used for the microarrays.
All samples used the identical forward primer GACCACCGCATCTCTACATTC and splice variant specific reverse primers (Fig. 1): survivin-WT, TGCTTTTTATGTTCCTCTATGGG; survivin-2B, AAGTGCTGGTATTACAGGCGT; and survivin-ΔEx3, ATTGTTGGTTTCCTTTGCATG [ 40] (Sigma).
The axial deformation and swelling pressure under zero lateral deformation can be determined by conventional oedometer using two identical samples.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com