Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
PCR products were sequenced using the Genetic Analyzer 3130xI (Life Technologies).
The nucleotide sequences of the DNA fragments with shifted peaks were determined using the Genetic Analyzer 310 with a BigDye Terminator (Applied Biosystems).
Similar(58)
The obtained PCR products of the parents and two offspring of one yellowtail family were sequenced directly using the ABI3130xl Genetic Analyzer (Applied Biosystems, CA, USA) or ABI3730xl DNA Analyzer (Applied Biosystems).
Fragments were sized on an ABI Prism and analyzed by capillary electrophoresis using the 3130-Avant Genetic Analyzer (Applied Biosystems).
Fluorescent denatured DNA products were analyzed by capillary gel electrophoresis, using the ABI3130XL genetic analyzer (Applied Biosystems), and the GeneMapper (Applied Biosystems) and PeakAnalyzer (Robiotec, Rehovot, Israel) softwares.
Following re-suspension in formamide, the samples were analysed using the ABI3730 genetic analyzer (Applied Biosystems).
Multiplexes were assembled according to amplicon size and tested on two individuals from each lab strain (n = 12) and three individuals from each of the three cities sampled (n = 9) by size fractionation using the 3730 Genetic Analyzer (Applied Biosystems) [32].
Then the PCR products were depurated and sequenced directly using the 3130 genetic analyzer (Applied Biosystems, USA).
Twenty-four colonies for each PCR product were sequenced using the 3730 Genetic Analyzer (Applied Biosystems).
The genotyping assay was carried out using the ABI3100 genetic analyzer (Applied Biosystems, Warrington, UK).
Gel-purified small RNAs were ligated to the 3' adapter (TCGTATGCCGTCTTCTGCTTG), and the resulting small RNA libraries were sequenced using the Illumina Genetic Analyzer.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com