Your English writing platform
Discover LudwigSuggestions(5)
Exact(1)
The sequence to analyse was A/GTCTCCCTCAT using the forward sequence primer 5′-CTCCGCTGCAAATAC-3′.
Similar(59)
Pyrosequencing was performed on a PSQ™96MA Pyrosequencing System (Biotage) with the PyroGold SQA reagent kit (Biotage) using the forward sequencing primer 5'-CCAGCTTGCCGTCAC-3'.
We first produced 32 000 shotgun reads from the 1 1.5 kb library and 14 000 reads from the 4 5 kb library using the forward sequencing primer.
version 7. Reads were trimmed for quality and separated by amplicon using the separate-reads-by-barcode function using the forward sequencing primer + five bases downstream as the barcode.
Evaluation of β-actin expression, used as control of the RNA amount, was carried out by using the forward primer sequence CAGAGCAAGAGAGGCATCCT and the reverse primer sequence TTGAAGGTCTCAAACATGAT corresponding to residues 216 235 and residues 405 424, respectively, which yield a 201-bp product.
Dicer mRNA was amplified using the forward primer sequence 5'-GGAA GCAGCCAACAAAAGAG- 3' and the reverse primer 5'-TGAGGGTTTTCTCTGCGTCT-3', amplifying a 145-bp region.
A single consensus sequence was assembled using the forward and reverse sequences using CodonCode Aligner v. 3.0.2 (CodonCode Corporation).
16S clones from each library were picked by sterile toothpick and reamplified using the forward adapter primer sequence (27fSeqAdapter; CTAATACGACTCAGCTATGCACT) and 1492r.
The upstream sequence breakpoints for each deletion were determined by aligning the reference sequence with the sequences generated using the forward primers in the sequencing reaction.
Polymerase chain reaction products were resolved through 2% agarose gels, visualised using a transilluminator, then analysed by pyrosequencing using the Biotage Sample Prep kit and using the forward primer for sequencing.
The PCR products were gel purified, cloned into TOPO TA vectors (Invitrogen) and sequenced using the forward and reverse M13 primers (Biopolymers Sequencing Core Facility at Harvard Medical School and Children's Hospital Boston Sequencing Core Facility).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com