Sentence examples for using the forward primer from inspiring English sources

The entire internal transcribed spacer sequence of the nrDNA region was amplified using the forward primer (5′-CTCCTCCGCTTATTTATATGC-3′) and the reverse primer (5′-TAGGTGAACCTGCGGAAGGATCATT-3′).

The resulting cDNA was submitted to PCR using the forward primer 5′-TGAGTTGCAGAACTGGATCG-3′ and reverse primer 5′-GCAGAACGCCAGAAAACTTC-3′ for detection of the G. graminis lox mRNA.

S1PR1 cDNA was quantitated using the forward primer 5′- CCGCTTGAGCGAGGCTGCTG-3′ and the reverse primer 5-CTATGATATCATAGTTGCCATAGTC-3′ (synthesized in Biolegio company, Netherlands).

A second, semi-nested PCR was performed using the forward primer 5'- GAGGGTTTAGTTTTTATTATTGTTAAGAAT -3' (same reverse).

Sequencing was performed using the forward primer and standard procedures on the ABI 3700 capillary sequencer.

The PCR products were directly sequenced using the forward primer, as described above.

The ePHD domain of ATX1 was PCR amplified using the forward primer phd-attB1 and the reverse primer atx1-attB2.

A 559-bp Bcl2l1 probe was made using the forward primer (FP) TGGTCGACTTTCTCTCCTAC and reverse primer (RP) AGAGATCCACAAAAGTGTCC.

This fragment was amplified by PCR using the forward primer GlobF and the reverse primer GlobR (Table 1) and cloned into pGEM-T Easy.

We amplified a 669 bp fragment of the mitochondrial cytochrome b gene, using the forward primer TTCCCGCACCTTCAAATCTT [20] and reverse primer GGACTAGGGCCGAAAGTATAAATA [21].

The SET domain of ATX1 was PCR amplified using the forward primer set-attB1 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGAATACTCCAAGCAAC-3' and the reverse primer atx1-attB2.