Sentence examples for using the follows from inspiring English sources

qRT-PCR analysis was performed using the follows primers annealing at CCDC6 amino-terminus: Fw: ggagaaagaaacccttgctg and Rv: tcttcatcagtttgttgacctga.

The piezoelectric efficiency, d 33, was calculated using the follow equation [32].

I "follow" their public updates using the follow feature, formerly subscribe.

Follow someone around using the follow command.

Using the "Follow me" tool, select the object's surface.

This abstract gives very little information about the technique used, the follow up of the child or the ethical approval process".

If he/she runs away from you, follow closely behind and once they stop, use the follow command again.

If you feel the urge to, use the follow command and repeat one word: "Stalk, Stalk, Stalk, Stalk..."....

Using the follow-fork-mode child option in the debugger, we debug the child process generated by Zygote.

Using the follow-up function (AutoRescan), we traced the lesions through all consecutive OCT series.

Analyses were conducted using the follow-up data available on 31 December 2010.