Suggestions(1)
Exact(1)
The spatial and temporal jacobians for FMT can therefore be calculated using the weight matrices computed for functional tomography (W a(t))using the following: Using the lifetime values estimated for the FRETing and nonFRETing donor species, we can therefore construct the weight functions for each FRET complex component (W FRET t) and W nonFRET t)).
Similar(58)
People have also had luck using the following (use with caution as some may irritate your skin): Petroleum jelly Carburetor cleaner.
If you suffer from arthritis, Carpal Tunnel Syndrome, or just a sore wrist after using a mouse, try the following: Use a wrist stabilizer while operating a mouse.
This algorithm calculates the minimum aligned distance between two time-series using using the following recursive equation: (1).
The free fatty acid number was calculated using readings of both titrations using the following formula.
We electronically searched PubMed and additional sources for published studies using the following search terms: use*, using, addict*, disorder*, naloxon*, narcan*, evizo, OEND, OOPP, THN, overdose, overdos*, educat*, train*, untrain*, un-train*, nontrain*, non-train*, and program*.
The PubMed and Scopus search engines were used to locate studies using the following search terms: 'lateral epicondylitis' and 'platelet-rich plasma' and 'clinical trial'.
Prediction analyses were performed using the following commonly used methods: Diagonal Linear Discriminant Analysis (DLDA) [23], K-Nearest Neighbour (KNN), Random Forest (RF) [24] [27], and Support Vector Machines (SVM) [23], [24], [28], [29].
The full-length human ACC2.v1 cDNA was amplified by PCR from human skeletal muscle Marathon-Ready cDNA (Clontech) was used as the template using the following primer pair: forward, 5'-GCCTAGGTAATGGTCTTGCTTCTTTGTCTATCTTGTCTG-3'; reverse, 5'-ACCGGTGGTGGAGGCCGGGCTGTCCATG-3'.
One µL of the lysate was used for nested PCR using the following primer sequences: Y-chromosome sense primer, 5' AATTGACAGCATCTACGTACTGGAGC 3' and antisense primer, 5' TCCAGGAGCTGATAAGCATAGAGAGC 3', second sense primer 5' AGCTCTACAGTGATGACAGGATTTTAAACC3', second antisense primer 5' TGACCTCAGAGCCATCTTTCCTCTC 3'.
Instead, the AM1-based free energy barriers were corrected afterward using the following (previously used) protocol.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com