Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
After identification of metabolites in the scan mode using the NIST data bank, quantification of labeling enrichment was done in SIM (single ion monitoring) mode in two technical replicates using the following unique fragments (m/z) containing the complete carbon skeleton of metabolites: pyruvate 174, lactate 261, alanine 260, glycine 246, serine 390, aspartate 418, glutamate 432, glutamine 431.
Similar(58)
(1) Real analyticity in the time variable One of the crucial steps in solving the inverse problem will be the use of the following unique continuation theorem of Tataru and Robbiano and Zuily (cf. [25, 29]) that requires the analyticity in (x_0): Real analyticity in the time variable.
Full length mouse TIMP-1 coding regions were amplified by PCR from mouse brain cDNA produced as described above, using the following primers containing unique restriction sites in their 3' end: TIMP-1/GFP-F: ATATATGAATTCTAAATGATGGCCCCCTTTGCATCTCTG (EcoR1), TIMP-1/GFP-R: ATATATGGATCCCGGGCCCCAAGGGATCTCCAAGT (BamH1).
The results demonstrate that microparticle preparation is possible by the following unique melt grinding technique without using organic solvents.
However, SCCs in evolving digraphs have the following unique properties, which preclude the use of Tarjan's algorithm.
(mathsf {GRAPE}) has the following unique feature.
Then we have the following unique existence result.
Diamantinasaurus matildae gen. et sp. nov. is characterised by the following unique association of features.
We have identified 561 proteins in total (data not shown) by using the following selection criteria: the number of unique peptides for protein - at least two - and a global FDR of 1% (based on the analysis in PSPEP, with threshold unused score for the protein equaled 0.4).
using the following parameters.
Avoid using the following for research.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com