The project was built using the following technologies: AWS (DynamoDB, Lambda & SES), Node JavaScript for the Alexa code, Swift for the iOS app and PubNub APIs for the chat room.
To compare the reliability and the agreement in measuring central corneal thickness (CCT) using the following technologies: RTVue Fourier-domain optical coherence tomography (Optovue, Inc., Fremont, CA), Pentacam (Oculus, Inc., Wetzlar, Germany), and ultrasonic pachymetry (USP; Pocket-II; Quantel Medical, Inc., Bozeman, MT).
Use the following technologies: Flash & Shockwave by Macromedia, SilverInsight by Microsoft, Java and more.
We searched MEDLINE, CINAHL, EMBASE, and the Cochrane Library from 1966 to September 2005 using the following search strategy: handheld technology AND electronic medical record AND randomized controlled trial.
Mutation (5 bp, GGAAU) was introduced into the miRNA binding site with QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) using the following primers: Fwp63Mut gtttttggttggaggaaaattcttaaaaggcccatagcagc Revp63Mut gctgctatgggccttttaagaattttcctccaaccaaaaac.
The first round of amplification was performed in a Stratagene™ thermocycler (Agilent Technologies Company) using the following conditions: activation at 95°C for 10 minutes, 45 cycles of denaturation at 95°C for 30 seconds, hybridisation at 59°C for 30 seconds, elongation at 72° C for 1 minute.
Xsmad2-P445H was cloned by inducing a point mutation at amino acid 445 (CCT to CAT, Eppert et al., 1996) using the QuikChange II Site Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) using the following mutagenesis primers: forward 5′-GAGCTTCACCTGAATGGACACTTGCAGTGGTTGGACAAAG-3′ and reverse 5′-CTTTGTCCAACCACTGCAAGTGTCCATTCAGGTGAAGCTC-3′.
The root tissue was then homogenized using a Precellys 24 cryo-mill coupled to a Cryolys (Bertin Technologies, Villeurbanne, France) using the following setting: 3 cycles involving 30 s of milling at 6,800 rpm followed by a 30 s rest period between cycles.
Variable heavy chain sequences were subcloned from pCR®T7/CT-TOPO® (Life Technologies, NY, USA) plasmid into a mammalian expression vector pCMV6-AC-FC-S containing C-terminal mouse Fc sequence (OriGene technologies, MD, USA) using the following strategy.
Real-time PCR reactions were run on an MX3000p real-time PCR machine (Agilent Technologies, Cheshire, UK) using the following conditions: 95°C for 2 min, 40 cycles of 95°C for 15 s, and 60°C for 30 s. Real-time PCR reactions (25 μl) were run using a 10-μl cDNA template together with SYBR green master mix (VHBio Ltd ,Gateshead, UK) and gene-specific primers (100 nM).
Cuhls [10] classified research problems of technology foresight processes using the following dimensions of the research problems: 1. Explorative vs. selective 2.
