To help you answer these questions, I propose using the following specific definition.
The expression of each molecular marker was detected by PCR using the following specific primers: Xbra, upstream, ggatcatcttctcagcgctgtgga, and downstream, gttgtcggctgccacaaagtcca.
The expression of each molecular marker was detected by PCR using the following specific primers: XmyoDa, upstream, agctccaactgctccgacggcatga, and downstream, aggagagaatccagttgatggaaaca, Xbra, upstream, ggatcatcttctcagcgctgtgga, and downstream, gttgtcggctgccacaaagtcca.
Immunoblotting was performed as previously described [14] using the following specific primary antibodies: anti-filaggrin, anti-loricrin, anti-keratin 14 (Covance, Berkeley, CA); anti-HA (Sigma Chemical Corp., St Louis, MO) and anti-p21Cip1 (F-5; Santa Cruz, CA).
Reverse transcription-PCR was performed with an automatic thermal cycler (iCycler, Biorad) using the following specific primers: iNOS mRNA sense (5'-ATGCCAGATGGCAGCATCAGA-3', exon 8) and iNOS mRNA antisense (5'-ACTTCCTCCAGGATGTTGTA-3', exon 11).
A human-specific AKAP12β probe was PCR amplified from human coronary artery SMC (HCASMC) cDNA using the following specific primers: forward, 5'- gattaggatccccgctgaccactcacagag -3' and reverse, 5'- gattgaagctttgtgatggtgatggtcccc -3' amplifying a 421 bp probe.
We used the following specific antibodies for western blot: anti mouse TNFα (abcam, # ab6671), anti- NFκB p65 (SantaCruz Biotechnology, # sc-109), HRP-anti-actin (Sigma, #A3854).
For that, we used the following specific primers Fw: 5'GGC ACA CGT GGC TTT TCG 3'; Rev: 5' GGT GAA CCT GCT AAG TTT ATG CAA 3', previously described [58].
To generate the plasmid expressing ERGIC3, we cloned the open reading frame of ERGIC3 and used the following specific primers (upper case, restriction enzyme sequences): forward, 5'-GGTGGTGAATTC atgaggcgctggggaagct-3'; reverse,5'-GGTGGTGGATCCaccgaggagggtgactacgttgtctt-3'.
The percentage of specific apoptosis was determined using the following formula: specific apoptosis = (drug-induced apoptosis − spontaneous apoptosis)/(100 − spontaneous apoptosis)100%.
The c-JUN coding sequence was amplified from chicken leg muscle cDNA using PCR and the following specific primers: 5′-CCGCTCGAGGCCACCATGGAGCCTACTTTCTACGAG-3′ and 5′-CGGGGCCCCGCTTCTACCGTCAGCTTTAC-3′.
