Sentence examples for using the following setting from inspiring English sources

Mass spectrometry analysis was carried out on a time-of-flight mass spectrometer Micro-TOF-QII (Bruker Daltonik GmbH, Germany) using the following setting of tuning parameters: capillary voltage 4.5 kV, drying temperature 180°C, nitrogen flow rate 6 L/min and pressure 0.8 bar.

The root tissue was then homogenized using a Precellys 24 cryo-mill coupled to a Cryolys (Bertin Technologies, Villeurbanne, France) using the following setting: 3 cycles involving 30 s of milling at 6,800 rpm followed by a 30 s rest period between cycles.

The effects of media glare were reduced using the following setting: temp 7500, tint +30, exposure +2.80, brightness +50, contrast +25.

The Structured selections have been made using the following sets of simulation points in Fig. 8: the groups go from 0 to 8 (each having its own color).

In the second step aliquots of the 670- and/or 540-bp amplicons are analysed by nested-PCR using the following sets of primers: the forward se[adej] together with the reverse sea, sed, see and sej, and/or the forward se[bc] plus reverse seb and sec.

The purified amplicons are then cloned into pMD-18 T vector by TA cloning (Takara) using the following set-up in Table  9.

Relative quantification by real-time PCR of ERdj5 against endogenous β-actin-expression levels was measured using the following sets of primers: human ERdj5 forward (5′ TGAACTACTTTCGGCAAAGAGA 3′) and reverse (5′ TTTCAGCTCAGGATCATTTGAA 3′); human beta-actin forward (5′ CCAACCGCGAGAAGATGA 3′) and reverse (5′ CCAGAGGCGTACAGGGATAG 3′).

For V, W ∈ X × X, we shall use the following setting in the sequel: V ∘ W = { ( x, y ) | there exist  z ∈ X : ( x, z ) ∈ W  and  ( z, y ) ∈ V }. and V − 1 = { ( x, y ) | ( y, x ) ∈ V }.

Ithurria et al. used the following set of effective masses for quasi-two-dimentional CdSe NPLs: mLH = 0.19mo (for light hole) and mHH = 0.89mo (for heavy hole).

For ChAT, we used the following set of primers: forward primer (5' GTTGGTATGACAAACCCATG-3'), reverse primer (5' TGAATCGGCTCGGAGT-3'); whereas for GAD detection we used the following primers: forward primer (5' CAGCCTTGGGTATTGGTACAGA-3'), reverse primer (5' CAGCTGTGGCACTCACTAGAA A-3').

Where ambiguity was used, the following sets of equivalencies were used: [ILMVF], [FYW], [FYH], [KRH], [DE], [ST].