Sentence examples for using the following pair from inspiring English sources

The miR168 sequence was first mutageneized using the following pair of primers: 5'-cgtgtcggtgtcagccaatcagttcccgacctgcaccaagcgaatccgagaccgccggtaac-3' and 5'-cgtgtcggtgtcagccaatcagtgccggacctccaccaggcgaatccgagaccgccggtaac-3'.

The miR168* sequence was subsequently mutageneized using the following pair of primers : 5'-cacctcggactccgattcagctgatagaagaccggcgctcacaaaccaaccatgacaagacacg-3' and 5'-cgtgtcttgtcatggttggtttgtgagcgccggtcttctatcagctgaatcggagtccgaggtg-3'.

To generate the cis plasmid for AAV packaging (pcisAV.RSV.MCAT), we first amplified the MCAT gene from poCAT using the following pair of the primers.

The pLV.CMVPpy RE8.NEO vector was constructed by amplifying the Ppy RE8 gene from pGex Ppy RE811, using the following pair of primers:Ppy RE8ForAscI taggcgcgccgaggacgccaagaacatca and Ppy RE8RevXhoI:aatctcgagtcagatcttgccgcccttctt, and inserted in the MCS of pLV.CMV.bc.NEO.

The SP I nuclease gene was amplified from the pSP plasmid using the following pair of primers: 5' GGG CTCGAGATGTCGCGTTCTACTTGTTTTGTTTC and 5' GGA GGTACCGAATTCA GTGGTGGTGGTGGTGGTGTTCTTCTGTGGCGACTACCATTGCTT.

To confirm the presence of the hGAD65 gene, PCR was performed using the following pair of hGAD65 specific primers: forward 5'- AAGAATTCTGGCATCTCCGGGCTCTG-3' (Gand1), and reverse 5'- AATTCTCGAGTTATAAATCTTGTCCAAGGCG-3' (GAD-2).

Overlapping fragments of the 16S ribosomal RNA gene (rrs) were amplified by PCR from the blood of patients using the following pairs of primers: 16S5'-16S4R, 16S1F-16S7R, 16S6F-16S11R, 16S6F-16S11R, and 16S8F-16S3' (Table 2).

PCR analysis of the MTL configuration was carried out in pUA12 and pUA15 cells, through amplification of oBPα and MTLa1 genes, respectively, using the following pairs of primers: 5' GTGGTCAATGGAGCTGATAC 3'and 5' ACATGTGGTCGCCCAACTCC 3'; 5' TTGAAGCGTGAGAGGCAGGAG 3' and 5' ATCAATTCCCTTTCTCTTCGATTAGG 3'.

Synthesis of the DNA template was performed by PCR using the following pairs of oligonucleotides: tatAd-for (5'-ATGTTTTCAAACATTGGAAT-3') and tatAd-rev (5'-CTAATACGACTCACTATAGGGAGAGCCCGCGTTTTTGTCCTGCT-3'), tatAy-for (5'- andCCGATCGGTCCTGGAAG-3') and tatAy-rev (5'-CTAATACGACTCACTATAGGGAGACTGATCTTCTTTCTTTTTTT-3').

PCR of the cDNA was performed using Platinium High Fidelity Taq using the following pairs of primers: PDE5 sense: (5'-3') ACC GCT ATT CCC TGT TCC TT PDE5 antisense: (5'-3') AAG GTC AAG CAG CAC CTG AT PCR parameters were: 35 cycles (94°C for 45s, 58°C for 45s, and 72°C for 1 min).

Thereafter, 1 l of the reaction mixture was amplified by PCR using the following pairs of primers: 5′-CCAGCAGCAGGCAGCACTTG-3′ (sense) and 5′-CACGGGCGCTGCACCACTAC-3′ (antisense), to produce a 420-bp fragment of the DAPK gene.