Sentence examples for using the conditions described from inspiring English sources

Using the conditions described in the Experimental Sect.

F ab' 2 fragments of trastuzumab and HuM195, an anti-CD33 mAb (a gift from Dr. McDevitt, Memorial Sloan Kettering Cancer Center) were also prepared using the conditions described for panitumumab.

The residue was purified using reversed-phase HPLC using the conditions described above followed by lyophilization.

When later reports failed to confirm the link to CFS, they were often criticised for not using the conditions described in the original study.

Using the conditions described in Methods S1, in buffer containing 2 mM of each dATP, dCTP, dGTP and 4 mM dUTP it was possible to degrade 98% of the DNA.

The microRNA let7a was used as an internal standard using the conditions described above and using the TaqMan MicroRNA Assay (Applied Biosystems) specific for mature let7a RNA (Part number: 4427975 Assay ID: 000377).

DMR1 amplicon was obtained by nested PCR with the second PCR performed on 5 μl of the initial amplification using the condition described by Lopes et al. [ 30].

TLC used under the conditions described in the manuscript is capable of separating TAGs from other classes of glycero-lipids.

The amplification was carried out using the conditions previously described by (Zhang et al. 2015a, b).

PCR reactions were performed using the conditions as described [62].

The HoxB7Cre allele was amplified using the primers 5'-CCATGAGTGAACGAACCTGG-3' and TGATGAGGTTCGCAAGAACC to give a 400 base pair band using the conditions previously described.