Sentence examples similar to using the computer based program from inspiring English sources

The randomization list was generated by an independent pharmacist using the computer-based program design by Trombult Programing.

Analysis of the individual comets to generate quantitative data was performed using a computer based program ([34], VisComet; Impuls Computergestutzte Bildanalyse GmbH, Gilching, Germany).

Patients were randomly assigned to two groups using a computer based program.

Statistical analysis was performed using the computer-based program GraphPad Prism.

Statistical analyses were performed using the computer-based program SPSS (Statistical Package for Social Sciences) version 10.0.

The data obtained after experimentation was statistically evaluated using ANOVA at significance level of p < 0.05 by using computer based program SPSS.

To retain as much of the temporal response information as possible we used a variant of a computer based program called FeelTrace, Figure 1 [19].

Randomization was performed with a computer based program at the beginning of the trial and no blocks were used since this is not viable in our study design.

The method of linear programming is applied by using the computer-based modelling program GAMS.

β-actin forward (TCCCTGGAGAAGAGCTACG) and reverse (GTAGTTTCGTGGAT GCCACA) primers and SELENBP1 forward (TCATCAGGGAAGGCTCTGTGA) and reverse (GGGTGCCAAGAGAGAGCAGAA) primers were designed using the computer program OLIGO based on the cDNA structure of the genes published in Genebank.

Some of the models use agent based systems where the computer based players are programmed using parameters gained from research and the computer simulates the virtual players attempting to evacuate the building (Rüppel & Schatz 2011).