Sentence examples for using the appended from inspiring English sources

Using a three-step PCR protocol, a V5 tag was inserted in between LexA and Dot1 to generate PADH1-LexA-V5-Dot1 (primers LexADot1V5P2 and LexADot1V5P3), and the resulting PCR fragment was cloned in pRS425 using the appended NotI and SpeI sites.

You can continue to add files and directories to your.tar archive files by using the "append" flag: You can continue to add files and directories to your.tar archive files by using the "append" flag: You can continue to add files and directories to your.tar archive files by using the "append" flag: r - This is the "append" flag.

Perhaps that's because the iPhone app lets you take pictures using the camera, append a note and save it to your Evernote page, where it is archived and searchable.

The DNA constructs were used to transform DH5α competent bacteria cells and the recombinant wild-type and mutated FNIII B-8 fragments were purified from the bacterial lysate on Ni-NTA columns (Quiagen, Hilden, Germany) using the His6 tag appended at the N-terminus of the FN fragments, according to the manufacturer's instructions.

For any gene missing an orthologous partner in another species even after complementation with the array data, known orthologs were appended using the resource available at PlasmoDB (version 5.5).

Molecular CMR imaging is performed using the paramagnetic gadolinium chelate covalently appended to a variety of target vectors including antibodies, peptides, or small molecules probes [ 118].

Using the same forum account to append a comment to that announcement, the apparent hacker warned Satoshi that his details were for sale.

The N-terminal TAPi tag was amplified with a high-fidelity polymerase from the gateway cloning vector ntapi.289.gw using the following primers designed to append SalI restriction overhangs: Forward: AAGTCGACCGTGGTGGACAACAAGTTCAA Reverse: TTGTCGACGAAGAAGATCCTCCTCCTCCCAGTGCGCCGCTG Adenosine overhangs were added with Taq polymerase, and the fragment was cloned into pCR2.1.

If the ':' form is used, the file is appended to.

If the : form is used, the file is appended to.

For example, when using the above changes, data should be appending to the Year field on the Append To row.