Sentence examples for using templates that contained from inspiring English sources

This study examined the bypass of γ-OH-PdG by Sulfolobus solfataricus Dpo4, the prototypic Y-family DNA polymerase, using templates that contained the adduct in either the 5′-CXG-3′ or the 5′-TXG-3′ sequence context.

To further explore the effects of local sequence context on the kinetic signatures of 5mC and 5caC, we used a synthetic SMRTbell template that contained a modified base in a 5'-CG-3' sequence context, surrounded by two random bases on each side.

Templates were prepared using forward primers that contained the T7 RNA polymerase promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA [T7]).

The DNA templates were generated by PCR from cDNA clone LD 40196 (γ-tubulin 23C), using PCR primers that contained the T7 RNA polymerase minimal promoter sequence.

Avoid using mouthwash that contains alcohol.

One should use toothpaste that contains fluoride.

Do not use toothpaste that contains silica.

Never use products that contain ammonia.

Use a gel that contains hyaluronic acid.

Use a moisturizer that contains lactic acid.

Use simple URLs that contain keywords.