Your English writing platform
Discover LudwigExact(3)
Enzymes are quantified and gene expressions are investigated using respective primers and quantitative RT-PCR.
A 1 10 dilution of the resulting cDNA was used as a template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 Sequence Detection System) using respective primers and SYBR Green.
Of the resulting cDNA, 30 ng/μl was used as the template to quantify the relative content of mRNA by real-time PCR (ABI PRISM 7700 sequence detection system, Applied Biosystems, Foster City, CA USA) using respective primers and SYBR Green.
Similar(56)
The amplified PCR fragments were then used as a template for generating promoter constructs carrying deletions or mutation using respective primers.
The expression levels of specific mRNAs were determined by qPCR using respective primer pairs (Additional file 5).
Error bars indicate RQ max and RQ min. Templates of cDNA for axolotl patched- 2 319 bp) and pax7 (303 bp) were amplified by RT-PCR using respective sense primers linked to SP6 promoter sequence and anti-sense primers linked to T7 promoter sequence.
After an initial reverse transcription, the cDNAs obtained were amplified using the following respective primers and PCR conditions: GCLC was amplified by 32 thermal cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 mins followed by an extension at 72°C for 10 mins using primers: for' 5'gtggtactgctcaccagagtgatcct and rev' 5'tgatccagtaactctgggcattcaca.
NA genes were mutated according to the procedure of the QuickChange II Site-directed Mutagenesis kit (Stratagene, La Jolla, CA) by using respective mutated primer pairs.
The corresponding coding regions were amplified using respective pairs of primers by PCR (Table 2).
For each sample, 1 µg of total RNA was reverse transcribed using iScript™ cDNA Synthesis Kit, according to the manufacturer's protocol and used for qPCR in combination with respective primers and SYBR green supermix.
The latter contained the respective primers and probes.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com