Your English writing platform
Discover LudwigSuggestions(5)
Exact(2)
During the 1990s OW emerged as a candidate technology for data transmission in personal communications systems using protocols developed by the Infrared Data Association [2].
We amplified exon 2 of the Class I genes from genomic DNA using protocols developed by Siddle and colleagues [ 9] with modifications in the reverse primer sequence (5'- CTCGCTCTGGTTGTAGTAGCC 3').
Similar(58)
Detection of DNA damage in the PBMCs was done by SCGE or Comet assay using protocol developed by Singh and Tice et al. method [[24]].
Total RNA enriched with sRNA fraction was isolated using protocol developed by Ghawana et al. [ 45] combined with miRNAeasy spin kit (Qiagen, Germany).
The cartridge was calibrated by the XF machine, and following calibration the XF plate with mitochondria attached to the bottom was introduced into the machine and the assay continued using protocol developed by Rodgers et al. for rat heart mitochondria (Rogers et al., 2011).
We used protocols developed by the National Institute for Occupational Safety and Health (Dick et al. 1990, 1999; National Institute for Occupational Safety and Health 1995) and the University of Cincinnati (Bhattacharya et al. 1987 , 1995, to assess postural sway.
The medical support unit used protocols developed by a base hospital medical director who, together with EMS staff, reviewed each paramedic's chart daily to make appropriate follow-up decisions.
A widely used protocol, developed by Eberwine and colleagues, uses T7-based linear amplification [ 14].
Therefore, we adopted the widely used protocol developed by Damerval et al. [ 18] and introduced some modifications including a preliminary de-fatting step of peanut seeds for 2-D PAGE separation.
All diagnostic testing was conducted using protocols developed and validated by the South Dakota State University Animal Disease Research and Diagnostic Laboratory.
These neural progenitors could further differentiate into functional glutamatergic, dopaminergic, and spinal motor neurons as well as astrocytes by using protocols developed for hESC[16], [18], [21].
More suggestions(2)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com