Sentence examples for using primers that overlap from inspiring English sources

Presence of PVL determinants was detected by PCR by using primers that overlap with previously published primer sequences (18, 19 ).

In general, the upstream and downstream sequences (approximately 1 kbp each) of the target regions, and the gene cassette encoding thermostable resistance to kanamycin (kat) or bleomycin (blm) (chemically synthesized using sequence data from [ 62]) were PCR-amplified using primers that generated sufficient overlaps.

To make the CydX homologue-overexpression plasmids, the short genes were created through overlapping PCR using primers that spanned one half of each gene plus 15 nucleotides for a region of primer overlap.

(e) Colony PCR of transformants using primers that target cmx.

The resulting product was then further amplified in the second round of PCR using "universal" primers that overlapped and completed the attB1 and attB2 sequences.

To clone AsPbf1 into the plasmid, it was amplified using primers with ends that overlap the target insertion site sequence (AsPbf-F AGCTAGATTGTTGAGCATTACATCAGGGAGCTGCT and AsPbf-R TCATTTGGAGAGGACCATGGAGGAAGTGTTGTCAT).

A codon optimised HGyV-Apoptin gene was constructed using primers overlapping by 15 bases (Table 1).

Mutation screening involved the entire coding region using primers overlapping the exon-exon boundaries.

Proper integration of the S. cerevisiae URA3 marker was verified using a reverse PCR primer that overlapped the URA3 marker (either URA3-CHECK or URA3-CHECK#2) and forward PCR primer that was complementary to genomic sequences upstream of the 5′ region used to perform homologous recombination (termed CgZCXX-check, see Table S1).

Site-directed mutagenesis was performed using primer overlap extension methods [81] and codon deletion was verified by DNA sequencing.

The two fragments were joined by overlapping PCR using primers DC348 and DC351 to generate a 2,020 bp product that was cloned into pDCW88 [ 28] using the Kpnl and EcoRI sites.