Sentence examples for using primers that contained from inspiring English sources

Fragments of R. sphaeroides genomic DNA were amplified by PCR using primers that contained appropriate restriction sites, listed in supplementary table S2.

The ORFs of four genes (SUMO, MnSOD, sericotropin and TCTP) were amplified by PCR, using primers that contained restriction sites.

The DNA was made by PCR using primers that contained an internally labeled thymidine 35 bp from the 5′ end of the primer (indicated as bold and underlined).

Recombination was performed by amplifying a mCitrine-Kan(R) cassette using primers that contained 50bp of homology flanking the start codon: pdgfrb_HA1_mCitrine, TTTGGCTTTGAGGCGAATCAGTCATGTTGTTTTCTCTCCGTCTGCAGTGTACCATGGTGAGCAAGGGCGAGGAG and pdgfrb_HA2_Kan(R), TGGATGCGGCTGATGGTCGAACTCTTCATGCTTTCTTCTAGAGCAGGACATCAGAAGAACTCGTCAAGAAGGCG.

Specifically, we PCR amplified the gene of interest (including its native promoter) and adjacent 'floxed' cm cassette using primers that contained homology (45 nt) to the plasmid insertion site.

Constructs for reconstituted functional analysis ('FVKM RNAs') were built by PCR from the CrPV1-1 vector using primers that contained the appropriate mutations and flanked with restriction sites for cloning into pUC19 (without ribozymes).

To generate a regulated expression plasmid with this system, the target gene is first amplified using primers that contain attB2 and attB3 sites at their 5' ends and recombined into pDO23A.

In the present experiments I used primers that contained the full 48 bp sequence of the FRT site flanked by 23 nucleotides of 'buffer' sequence.

For the latter method, the sequence of interest was amplified from yeast genomic DNA using primers that each contains 20 bp of homology to the sequence of interest and 40 bp of homology to either end of a gapped CEN4/URA3 vector lacking an ARS.

DNAs from BL cell lines or formalin-fixed, paraffin-embedded primary BL cases were modified with bisulfite using the Epitect Bisulfite Kit (Qiagen) according to the manufacturer's protocol, and amplified using primers that did not contain CpG.

Amplification of the above mentioned genes was carried out using 5′ primers that contained a restriction Sfu I site, followed by an optimized Kozak consensus sequence (ATGG), as well as a start codon, and a 3′ primer containing an EcoR I restriction site (Table 1).