Sentence examples for using primers that contain from inspiring English sources

Exact(1)

To generate a regulated expression plasmid with this system, the target gene is first amplified using primers that contain attB2 and attB3 sites at their 5' ends and recombined into pDO23A.

Similar(59)

Fragments of R. sphaeroides genomic DNA were amplified by PCR using primers that contained appropriate restriction sites, listed in supplementary table S2.

The ORFs of four genes (SUMO, MnSOD, sericotropin and TCTP) were amplified by PCR, using primers that contained restriction sites.

The DNA was made by PCR using primers that contained an internally labeled thymidine 35 bp from the 5′ end of the primer (indicated as bold and underlined).

Recombination was performed by amplifying a mCitrine-Kan(R) cassette using primers that contained 50bp of homology flanking the start codon: pdgfrb_HA1_mCitrine, TTTGGCTTTGAGGCGAATCAGTCATGTTGTTTTCTCTCCGTCTGCAGTGTACCATGGTGAGCAAGGGCGAGGAG and pdgfrb_HA2_Kan(R), TGGATGCGGCTGATGGTCGAACTCTTCATGCTTTCTTCTAGAGCAGGACATCAGAAGAACTCGTCAAGAAGGCG.

Specifically, we PCR amplified the gene of interest (including its native promoter) and adjacent 'floxed' cm cassette using primers that contained homology (45 nt) to the plasmid insertion site.

Constructs for reconstituted functional analysis ('FVKM RNAs') were built by PCR from the CrPV1-1 vector using primers that contained the appropriate mutations and flanked with restriction sites for cloning into pUC19 (without ribozymes).

The C. glabrata CEN/ARS sequence was PCR-amplified from pGRB2.0 using primers that contained AatII restriction sites and then subcloned into the unique AatII site in the pUC19 backbone, thus creating pBM16.

The DNA sequences coding for the EGSs were generated by PCR using primers that contained the sequences complementary to the targeted region of the CCR5 mRNA and were under the control of the promoter for T7 RNA polymerase.

Initially, BRCA1 exon 17 was amplified including the surrounding intronic regions from the proband's DNA and one additional control, using primers that contained restriction sites XhoI and EcoRV in their 5′ ends.

In the present experiments I used primers that contained the full 48 bp sequence of the FRT site flanked by 23 nucleotides of 'buffer' sequence.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: