Sentence examples for using primers that appended from inspiring English sources

Exact(2)

Briefly, DNA templates were generated using primers that appended the T7 promoter sequence directly upstream of the aptamer sequence.

The coding regions were amplified from Mammalian Gene Collection Gerhard, 2004 #4 clones using primers that appended a tobacco etch virus (TEV) protease cleavage site (Phan et al., 2002) to the NH2-terminal end of the coding region and attL1 and attL2 Gateway adaptor sites to the 5ʹ and 3ʹ terminal ends of the amplimer products.

Similar(58)

(e) Colony PCR of transformants using primers that target cmx.

The corresponding DNA templates were first ligated and PCR-amplified with primers that appended a T7 promoter.

DNA coding for shuffled versions of the 65 central amino acids (residues 252 316) of the TOG1-TOG2 linker was obtained from IDT and amplified using primers to append flanking nucleotides of wild-type upstream and downstream flanking sequence.

The lig operon comprising the ligB and ligA genes was amplified from plasmid pPDL2 using primer set DSF0013/DSF0014 appended with NdeI- HindIII, respectively.

MT1A gene expression primers were designed using Primer 326.

I want to accumulate using append, by successively appending.

Before you repaint, it's probably a good idea to use a metal primer that's designed for exterior use.

The predicted repB gene downstream of oriT was amplified using a primer set DSF009/DSF0010 appended with BamHI and XhoI sites.

In the second PCR reaction, the forward primer 5' GGGGACAAGTTTGTACAAAAAAGCAGGCT 3' and the reverse primer 5' GGGGACCACTTTGTACAAGAAAGCTGGGT 3' were used to append sites for homologous recombination at the end of the PCR products.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: