Your English writing platform
Discover LudwigExact(14)
With so much investment headed toward Porsche's first all-electric vehicle, the German automaker is smartly using nomenclature familiar to its existing customer base, many of whom have never owned an EV.
To determine the incidence of uterine tachysystole (UT) using nomenclature defined by the American College of Obstetricians and Gynecologists (ACOG) and Association of Women's Health, Obstetric and Neonatal Nurses (AWHONN).
Using nomenclature consistent with that study, we employed the following primers: GSP 1, ACCCTTCTTCTAACGGC; GSP2, TTTCGTGCGGCAAACGAAGTC; and GSP3, TGAATTCATCTCAAATCTCG.
Labels for rhs genes were assigned using nomenclature described by Jackson et. al. (2009).
Gene Ontology annotation was developed by Compugen, using nomenclature obtained from the Gene Ontology consortium.
Using nomenclature from previous tropomodulin genes we designated these 5' UTR exons as E0 [ 27].
Similar(46)
They also used nomenclature rules as features and carried out extensive automatic post-processing of the results (e.g. checking if brackets are balanced within the chemical name).
The previously used nomenclature (SytA, SytB, SytC etc).
The used nomenclature is recommended by the Gene Nomenclature Committee of the Human Genome Organisation.
We chose to use nomenclature that maintains continuity with the literature.
A newly identified PBP2 type was designated XLI according to previously used nomenclature [ 12, 15, 46- 49].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com