Sentence examples for using meanwhile from inspiring English sources

In fact, at home tablets seem to stand in a class of their own for consumers, in that they are used alongside whatever else a consumer is using; meanwhile, that "whatever else" is often shifting, from TV to PC to mobile device depending on what users are doing.

"Using", meanwhile, equates social media with heroin abuse.

The visual references used, meanwhile, range from, "a telegram envelope to a double copy of a late Cezanne landscape".

In addition, in Method I, a current sensor is used meanwhile a voltage sensor is used in Method II.

To detect TMV positive RNA, the specific RNA probe sequence (5′ 3′) TTAAGTTGCAGGACCAGAGG was used; meanwhile, as a control, the unrelated RNA probe sequence (5′ 3′) AATTCAACGTCCTGGTCTCC was used.

Using Facebook, meanwhile, demands about all the creativity you'd need to renew a passport.

Weyerhaeuser was using 11%; meanwhile, Dentsply International was using 5%.

Using hashtags, meanwhile, allows spammers to get attention from those people searching Twitter's Trends.

Car use, meanwhile, has rocketed.

Natural gas use, meanwhile, would increase by 15 percent from current levels by 2035.

Heavy electricity use, meanwhile, could be limited by imposing power-usage standards on electronics manufacturers, as exist for refrigerators and washing machines.