Sentence examples similar to using forwarding from inspiring English sources

Similar(60)

Multi-task learning using forward selection of tasks.

Analysis was carried out using forward scattering versus side scattering.

The company is a nonhedged producer, meaning it does not sell unmined gold using forward contracts.

Viable cells were gated using forward and side scatter characteristics.

Identification of significant covariates for each outcome variable was made using forward stepwise regression models.

This conclusion is in agreement with previous analysis using forward-time population genetic models [30].

Prior to analysis, all samples were gated using forward and side scatter to exclude cellular debris.

MBP-C5a was amplified using forward primer 816 (CCAGAATTCCACCATCACCATCACCATCTCGAGCCGCGGGCCGATATGAAAATCGAAGAAGG) and reverse primer Va3'.

PBMC, B cell, or T cell populations were gated using forward and side scatter.

We analyzed the relative cell size by flow cytometry using forward angle light scatter.

Using forward and side scatter alone did not differentiate the two different cell populations.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: