Sentence examples for using different plate combinations from inspiring English sources

A total of 23 plastic femurs (Sawbones left foam femurs, #1129; Pacific Research Laboratories, Vashon, Washington) were tested using different plate combinations and IPDs.

To compare the maximum moment supported by different plate combinations for a given IPD, a one-way repeated measures analysis of variance was used.

In order to facilitate PCR error and bias recognition, all individuals (N = 40) were amplified twice in independent PCRs (referred to as amplicon replicates), i.e. each individual was included twice on the 454 plate using different barcoding tag combinations.

Printing on both sides of a sheet of paper and printing in three, four, or even five colours can be achieved in a rotary press by using different combinations and successions of plate and impression cylinders.

Transformants grown on LB plates with kanamycin were picked and the successful integration of the resistance cassette was verified by PCR using different primer combinations of k1 (CAGTCATAGCCGAATAGCCT), k2 (CGGTGC CCTGAATGAACTGC), kt (CGGCCACAGTCGATGAATCC), pdhr_downstream (TGATTTACAACATCTTCTGG) and pdhr_upstream (TGACTTCGGCAAGTGGCTTAAGAC).

Using pre-coated TLC F254 plates, the crude extract was fractionated using different combinations of hexane/ethyl acetate solvents (9∶1, 8.5∶1.5, 8∶2, 7∶3 and 5∶5) as the mobile phase.

The team extruded different grades of fibre using different combinations of proteins and salts".

Try varying the colors as well, using different combinations to achieve different aesthetic results.

Note: using different sizes of plates will achieve different looks.

Different carriers use different alphanumeric combinations.

Color paper plates using different colors and patterns.