Sentence examples for using an expression plasmid from inspiring English sources

Next, to confirm this result, we carried out a transient transfection experiment using an expression plasmid to express Tax in either Jurkat or HeLa cells.

Ectoptic expression of mir-200c was carried out using an expression plasmid containing the mir-200c precursor expressed from an EF-1 α promoter and a puromycin resistance marker (Cell Biolabs).

A plasmid to express the T238A mutation of Tub2p (yeast β-tubulin) was made by QuikChange (Stratagene) mutagenesis, using an expression plasmid for wild-type Tub2 as template and with primers designed according to the manufacturer's instructions.

Full-length human PRL cDNA was amplified using an expression plasmid previously described [ 23] as template with the following set of primers: 5′-ggtt gctagctcacgaacatgaacatcaaagga and 5′-gttt ggatccttagcagttgttgttgtggatgatt harbouring NheI and BamHI sites, respectively (underlined) to facilitate cloning to the corresponding sites of the pIRESneo2 expression vector (Clontech, Mountain View, CA).

In the absence of an antibody to TEV HC-Pro we used an expression plasmid (pMT-HC-Pro/K) that expressed a mutated HC-Pro (TEV K) containing an insertion of 3 amino acids in the central region of the protein [ 31] as a negative control to verify that any suppressor activity was due to an effect of the HC-Pro protein.

To this end, we used an expression plasmid encoding for full length AVEN.

To determine whether Sirt3 affects acetylation status of OGG1, we used an expression plasmid to overexpress Sirt3 or an siRNA to knock down Sirt3 expression in human glioma cell line LN229.

The pIRES2-EGFP vector (Clontech, Takara Bio Company, Shiga, Japan) was used as an expression plasmid during transfection.

As the backbone, we used pMC2, an expression plasmid with the high-level cold-inducible cspD2 promoter, and the ability for replication and selection in both E. coli and Halobacterium, recently constructed for investigation of a β-galactosidase protein from a related haloarchaeon [ 27].

Given the use of an expression plasmid with non-existing alternative splice sites and the expression in bacteria, it appears likely that YB-1/p18 is generated as an (auto- proteolytic frauto- proteolytic

For this end, a protocol for stable transfection and selection of zebrafish liver (ZF-L) cells using an adapted expression plasmid "ZF-L Exp" was developed.