Sentence examples for using a universal set from inspiring English sources

Environmental sustainability performance is evaluated using a universal set of equations that incorporates all the mentioned parameters.

Reverse transcription PCR was performed by using a universal set of primers (13, 14 ); whole-genome sequencing was performed by using an Illumina Genome Analyzer (Illumina, San Diego, CA, USA), as described by Ducatez et al. (15 ).

Specifically, the use of a "universal" set of ASPCR primers caused an overestimation of the K103N (ntAAC) mutation at position 103 of reverse transcriptase when primer binding site polymorphisms resided close to the 3′ end of the allele-specific primer.

While good query tools are extremely helpful, there is no substitute for the use of a universal set of standards during the study design phase that incorporates a standard vocabulary and nomenclature into the design process.

The use of a universal set of RA patients and control sera will allow a direct comparison of the diagnostic performance of current tests and those yet to be developed.

A more effective way is to choose a typical indoor scenario (primary scenario), calibrate the model using measured data to obtain a "universal" set of materials as a result of optimisation process.

As normal liver enzymes' reference ranges for each laboratory were not available in our data set, we used a universal cutoff of ALT>50 units/l of serum as an indicator of liver injury, and the AST/ALT ratio (in conjunction with ALT>50 IU/l) as a marker of possible cirrhosis and/or alcoholic liver disease (for AST/ALT>1) and advanced alcoholic liver disease (for AST/ALT>2).

To this end, the library containing plasmids were used as a template for 15 cycles of PCR using the universal set of primers flanking the fragment insertion site.

Our method neither requires special instruments nor specifically adapted buffers for each antibody and (with the exception mentioned above) dramatically exceeds the results of the standard protocol using one universal set of conditions for all antibodies tested.

Graph theory deals with the formal description and analysis of graphs and provides quantitative characterizations of any graph using a set of universal parameters.

16s rDNA was PCR amplified using a set of universal primers and probe (forward primer [P891F] 5'TGGAGCATGTGGTTTAATTCGA; reverse primer [P1033R] TGCGGGACTTAACCCAACA; UniProbe CACGAGCTGACGACARCCATGCA) that have been validated as sensitive and specific for bacterial detection to the limit of 5 pg of contaminating DNA [ 20, 21].