Dr Keith Small, an expert on Koranic texts at the University of Oxford, told The Times: "This gives more ground to what have been peripheral views of the Koran's genesis, such as that Mohamed and his early followers used a text that was already in existence and shaped it to fit their own political and theological agenda, rather than Mohamed receiving a revelation from heaven".
If the extraction used a text that contained no valid terms from the knowledge domain, then every extracted candidate term would be an invalid term (0% precision).
When we performed a blastn search of GenBank using a text string that included the minor sequence variant at both positions (ATTCTTCAAATATCTACTCATT), three of the 20 fully matching human results represented a NUMT on Chromosome 13.
The extraction and enrichment of the content of Annex VI was performed automatically, by processing the PDF document using a text recognition system that was configured to generate data using the controlled vocabulary.
Driel et al. [ 24] incorporate disease similarity information using a text mining algorithm that can be summarized as follows: First, each OMIM record is parsed and the keywords are searched for existence in the anatomy (A) and the disease (C) sections of the Medical Subject Headings Vocabulary (MeSH), which is a controlled vocabulary of U.S. National Library of Medicine.
Posner is using a text by Christopher Hampton that sticks closely to the original.
In some cases, a student may feel that by using a text or book not published in the local area, that the plagiarism won't be detected.
If the extraction software used a text corpus that consisted exclusively of valid, new nomenclature terms that should be added to an incomplete vocabulary, then all of the extracted candidate terms would be valid new terms (100% precision).
Likewise, a text that uses verbs like 'appear', 'seem', or 'ponder' give a different sense of reality than one using verbs like 'is', 'creates', 'proves' etc.
The first New England settlers used the Geneva Bible as a text that appealed to non-conformist congregations.
