Sentence examples for using a synthesised from inspiring English sources

Plasmids were sequenced by Beckman Coulter Genomics using a synthesised primer complimentary to an internal site in eGFP (GGCCGTTTACGTCGCCGTCC) and standard primers complementary to the T7 promoter and M13 reverse.

Plasmid DNA (pUC19 and pBR322) was sequence-specifically, covalently labelled with Cy3 fluorophores using a newly synthesised N-adenosylaziridine cofactor and the DNA methyltransferase M.TaqI.

Smith, D; Leach, M; Kellner, A, Indirect holographic imaging of antennas using an electronically synthesised "slow-wave", Ieee Antennas and Propagation Society, Ap S International Symposium (Digest), vol. 1 (September, 2004), pp. 703-706 [abs].

We devised a simple approach of growing vectors using a flow field synthesising approach.

Ideally, it could be studied in a clinical trial or, alternatively, using a model which synthesises the evidence from all available sources and levels of evidentiary quality [ 19, 20].

Cu2O nanocubes were synthesised using a previously reported seed-mediated approach1,3.

Bundles of single-wall carbon nanotubes (SWCNT) were synthesised using a chemical vapour deposition technique.

A molecularly imprinted polymer (MIP) selective for tylosin was designed and synthesised using a computational method (MIP "dialling").

Initially the mixed oxide nanopowder, containing 25 wt% gallia, was synthesised using a facile cost effective sol-gel procedure.

Total RNA was extracted from cells using Isogen II (Nippongene) and cDNA was synthesised using a Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer's instructions.

It is demonstrated that a reflection spectrum with desired number of channels can be easily synthesised using a general multi-variable optimization method.