Sentence examples for using a standard polymerase from inspiring English sources
Exons 16 and 17 of APP were amplified using a standard polymerase chain reaction (PCR) protocol.
HPV was detected by the amplification of DNA by using a standard polymerase chain reaction (PCR) protocol with L1 consensus primer pair MY09 and MY11, which promotes amplification of an approximately 450 bp product and can detect more than 40 distinct low- and high-risk genital HPV types.
Most PCR products were amplified using a standard Taq polymerase (New England Biolabs or Promega) or Hot Start Ex-Taq (Takara-Mirus) on MJ Research PTC 200 gradient and PTC 100 thermal cyclers.
Briefly, 3 μL aliquots of bacterial lysates were subjected to amplification, using a standard Taq polymerase (Life Technologies, Rockville, MD) in a total volume of 50 μL of PCR mixture; RAC1 and RAC8 and MTB-F and MTB-R primers [ 32] were used for identification of the Mycobacterium genus and of the strains belonging to the M. tuberculosis complex, respectively.
PCRs were done using a standard Taq DNA Polymerase kit (Qiagen).
Amplification primers 5´-CCTAACACATGCAAGTCGARCG-3´ (forward) and 5´-CGTATTACCGCGGCTGCT-3´ (reverse), both from Eurogentec (Seraing, Belgium) were used in a standard polymerase chain reaction (PCR) to generate a 490-bp fragment from the 5´ end of the 16S gene.
The extraction of the information is achieved using a standard laboratory technique called the polymerase chain reaction (PCR) [ 28].
PCR amplification to remove the stop codon was then performed using M3XbaF (5′-ctttcc tctagattccaggaa-3′, Xba I restriction site underlined) and M3R (5′- aagcttacgatgtatttgtccat attc-3′, Hind III restriction site underlined) using a standard protocol with P fu DNA polymerase.
The first stage used a standard (non-hot-start) DNA polymerase (Biolase™ Taq Polymerase, Bioline) in 25 ul reactions following the protocols of Kress, Wurdack, Zimmer, Weigt and Janzen [8].
The gene encoding aldolase can be amplified using the standard polymerase chain reaction (PCR) from a genomic DNA preparation using the Qiagen kit and primers flanking the gene with engineered restriction sites.
