Sentence examples for using a sense primer from inspiring English sources

Using a sense primer, 5'-CTCACAGCTAGCTTGGGTAACGCCAGGGTTTTC-3' and antisense primer, 5-'ACTGTATAGATCTCGCCCCTCGAATAAACAACGC-3', we amplified the ICP4 gene by PCR from DNA template, pGH108.

The coding sequence was amplified using a sense primer comprising a NheI site (5'-ATTAGCTAGCGCCACCATGGAGGGATTCGACGGTTCA-3') and an antisense primer containing a EcoRI site (5'-TGGAATTCTTAGGAATGAGCTACTGCATCTTCTACCTG-3').

The 1101-bp 3' flanking region was also amplified from the AG83 genomic DNA by PCR using a sense primer, 5'CGCGGATCCCCTGTCTGCCTCGCTGAC 3' and the antisense primer, 5' GAAGATCTGCCGGATCAAGCGTTCTC 3' containing BamHI and BglII sites (underlined).

Using G. m. morsitans salivary gland genomic DNA as a template, a PCR was performed using a sense primer in the 5'UTR (5'-CCTAAATCCTTTCTTTAAC-3') and a 3'end primer (5'-ATGAATAATCGTAATGCG-3') that span the entire coding sequence.

The Casp8p41 ΔDED construct was PCR amplified using a sense primer beginning with the Methionine at amino acid 86 (5'-ATGGAAAGGGAACTT-3') coupled with the Casp8p41 reverse primer and ligated into pGEM-T Easy (Promega).

Using a sense primer corresponding to the newly identified 5' end and an antisense primer in exon 16, we amplified a single product, from both wild type and Sacytm1Lex/Sacytm1Lex mouse brain mRNA, which extended from the newly described start site through exons 5 to 16 (Fig. 1B).

To increase assay sensitivity, a heminested PCR format was adopted that used a sense primer designed in a segment of the untranslated region that is highly conserved among all anelloviruses (5´-TCAAGGGGC AATTCGGGCT-3´).

To incorporate half of p53 shRNA palindromic sequence 5'-GACTCCAGTGGTAATCTAC (8) into PCR products, we used a sense primer, H1-5.1, and antisensense primer, p53-siRNA-3.1 (see Materials and Methods).

For reverse transcriptase-polymerase chain reaction (RT PCR), RNA samples (5 μg) were reverse-transcribed to cDNA using reverse transcriptase (ReverTra Ace, Toyobo Co. Ltd., Osaka, Japan) and subsequently amplified by PCR using as a sense primer, 5′-TCTCTCCGTAATGGAAGACC-3′ and an antisense primer, 5′-GCATTATGAGACATCCCCAC-3′ as previously reported (Takahashi et al, 1999).

To determine whether the mRNA contained the BTBD2 gene sequences directly upstream of the longest cDNA clone, RT-PCR was used with a sense primer complementary to the predicted start codon.

To further verify the killing of live A. hydrophila by the embryos, PCR analysis was performed using a primer set (sense primer, 5'- AATACCGCATACGCCCTAC-3'; anti-sense primer, 5'- amplifyingCTCaCGACAC-3') amplifying a specific region of A. hydrophila 16S rRNA gene.