Your English writing platform
Discover LudwigExact(13)
Full-length Lep DNA was amplified directly from the pGEM1 plasmid using a reverse primer with a stop codon at the end of the Lep sequence: 5′-CTATTAatggatgccgcc-3′48,49.
Animals were identified by polymerase chain reaction (PCR) using a reverse primer localized inside of aequorin and a sense primer inside the Lox stop: AeGFP.rev: TCAGTTATCTAGATCCGGTGG; LoxSTOP S: CGGGAAAAAGTTAGTTGTGG.
The trans-splicing product was amplified using a reverse primer M13 (5'-GTCATAGCTGTTTCCTGCGAC-3') 5' Cy3 labeled (564 nm emission max) (Intergrated DNA Technologies , Inc. and a mini-gene specific primer, pCI-Fwd [12].
For this species complex, we then developed a degenerated primer set (JB2-JB5 GED, Table 1) based on an alignment with the Genbank sequences we had downloaded before, the rhabditid sequences we had by then, and one Halomonhystera sequence we had obtained by using a reverse primer further downstream (JB7GED, Table 1).
This data was confirmed by qPCR using a reverse primer annealing in this region.
The second was amplified using a reverse primer encoding the mutated sequence and a forward primer binding to the vector backbone at nt 4500 (5′-CTACGGGGTCTGACGCTC AGTGGAAC-3′).
Similar(47)
When we performed the 5'-RACE experiments in order to identify the PEG10 transcription start site we used a reverse primer located in exon 2 which led to products with the exon 1/exon 2 junction sequence.
This made it possible to use a reverse primer that would anneal to wild type TERT transcript but not transcript from the construct.
To specifically detect CTGV, we used a reverse primer that annealed to the flanking regions of an 18-nt deletion in the HA gene, a molecular signature of the CTGV-like strains from Brazil (1, 3, 5 ).
To identify insertion events in PpHsp16.4a, we used a reverse primer located within the selection cassette (primer c) together with a forward primer (primer a), located outside the gene targeting construct in a genomic region upstream of PpHsp16.4a, that has no homology to sequences upstream of PpHsp16.4b.
Deep sequencing was conducted using a reverse sequence primer to read the 3′ ends of the RNA insert, which corresponds to the RNA synthesis site in the Pol II active site.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com