Sentence examples for using a reverse mutagenesis from inspiring English sources

Furthermore, using a reverse mutagenesis approach, we analyze the role of mutated amino acids upon the physicochemical factors that govern solubility of e-gp41.

A unique BamHI restriction site was introduced into the H60a sequence cloned into the pKG4 mammalian expression vector using the forward 5′caaatgccactcagctggatccacagtgaataacttc 3′ and the reverse 5′gaagttattcactgtaggatccagctgagtggcatttg 3′ oligonucleotides by directed mutagenesis using a QuickChange mutagenesis kit (Stratagene), according to the manufacturer's instructions.

Site-directed mutagenesis was conducted using a PrimeSTAR Mutagenesis Basal Kit (Takara) to obtain pYUC4m-pENTR/D-TOPO.

Using a somatic mutagenesis approach, we cloned a CARMA1-deficient T cell line.

Site-directed mutagenesis was performed using a QuikChange mutagenesis kit (Stratagene).

CXCR4 mutations were induced by site-directed mutagenesis using a QuickChange mutagenesis kit (Stratagene, Heidelberg, Germany).

All mutations were generated using a Quikchange mutagenesis kit (Stratagene).

Site-directed mutagenesis of PKC α-CDA was carried out using a Transformer Mutagenesis Kit (Clontech, Palo Alto, CA, USA).

Mutations in the AS3MT were introduced by site-directed mutagenesis using a QuikChange mutagenesis kit (Stratagene, La Jolla, CA).

Site-directed mutagenesis was performed using a fusion-PCR mutagenesis method [ 56].

Reverse transcription was performed using a SuperScript™ reverse transcriptase (Invitrogen).