Sentence examples for using a reference gene from inspiring English sources

Data have been normalized using a reference gene; (D and E) The expression of pluripotent genes in the four treatment groups described in the text; (F H) The expression of differential genes in the four treatment groups described in the text.

The qPCR data was analysed with the ΔCT method using a reference gene.

Consistent reaction efficiencies were confirmed for relative quantification using a reference gene [ 152].

Integrity and quality of mRNA (contamination assessment of genomic DNA) were checked with the A260/A280 ratio with Nanodrop (Thermo Scientific) and on agarose with a classical PCR using a reference gene (see primers below).

All copy numbers were calculated with the ΔCT method using a reference gene and calibrator sample (essentially the same as the ΔΔCT method [ 2] but calculated in a different order) on a home-made spreadsheet for the calculations.

Normalization using a reference gene was not possible, due to the varying abundance of degradation intermediates, and fractionation into the poly(A)+ and poly(A)− RNA impeded the use of spike-ins for this purpose.

To normalize the amount of cDNA, we sampled equal tissue sizes, quantitated RNA, assessed its quality prior to reverse transcription, and used a reference gene.

β-tubulin was used a reference gene.

CCDC12 was used a reference gene as its expression was unchanged and stable for the subjects in this cohort.

β-Actin was used as a reference gene using primers (Invitrogen) 5′-CCCAGCACAATGAAGATCAA-3′ forward and 5′-CGATCCACACGGAGTACTTG-3′ reverse with probe 63 (Roche, Lewes, UK).

The previously used C7orf28B was used as a reference gene (F: 5′-3′ CandACAGGTTGACCAAGGA and R: 5′-3′ TTGTGCAGGATCAGAGCATC) [ 29].