Your English writing platform
Discover LudwigSuggestions(1)
Exact(4)
Genomic DNA contamination was controlled in each RNA sample using a reaction mix lacking reverse transcriptase.
Thermocycling was performed in a MyIQ thermocycler (Biorad, Hercules, CA, USA) using a reaction mix containing syber green.
Semi-quantification of MtGS2b-α, MtGS2b-β, MtGS2a and elongation factor 1-α (Elf1-α) transcript levels was performed using a reaction mix composed of 50 ng of cDNA as template, 2 mM dNTP's, 10 pmol primers (additional file 2, Table S3), 1.5 mM Mg2+, and 0.25 units of Taq DNA Polymerase (AbGene Limited) in a total volume of 50 μL.
The assays were performed using a reaction mix of 6 μl per sample, consisting of 2 μl of diluted cDNA template, 0.12 μl of each primer (10 μM), 3 μl Light Cycler 480 SYBR® Green I Master mix, and 0.76 μl DNAse/RNAse free water (5 Prime GmbH, Hamburg, Germany).
Similar(56)
From HBoV-positive DNA eluates 5 µl were used in a reaction mix with a total volume of 25 µl.
For the sequencing, 1 μl PCR product was used in a reaction mix of the standard kit supplies and 0.5 μM primer in a final volume of 10 μl.
The relative expression of hypoxanthine phosphoribosyl transferase (HPRT) (Sense 5′ GCGTCGTGATTAGTGATGATGAAC 3′/Antisense 5′ GAGCAAGTCTTTTCAGTCCTGTCCA 3′) and IL-18 (Sense 5′ acagtgaagtaagaggactggctg 3′/Antisense 5′ CAGGTGCATCCATTTCCTCAAAGG 3′) were assessed via RT-PCR using a reaction containing SYBR green master mix (Finnzymes), 0.1 μg cDNA and 50 pmol of primers.
To prove the sensitivity of the fidelity assay, we also amplified the template using KOD polymerase in a reaction mix of undisclosed composition provided by the manufacturer of the enzyme.
Several dilutions of this cDNA were prepared and qRT-PCR was performed in 25 μl reaction volumes using a standard PCR reaction mix for Phusion DNA polymerase (Thermo Scientific), with the addition of 1.25 μl 500× diluted SYBR Green (Life Technologies) in DMSO.
Five μL of target DNA was amplified in a 50 μL reaction volume using Sigma REDTaqTM ReadyMix TM PCR reaction mix (Sigma St. Louis MO, USA) according to the manufacturer's instructions.
PCR products were sequenced from the 5' end (relative to the mRNA) on an ABI 373 or ABI 3730 sequencer using ABI Big Dyee" reaction mix.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com