Sentence examples for using a reaction based from inspiring English sources

To this endeavor, a new method has been developed which integrates a tailored approach using a reaction based fluorescent turn-on probe for the selective recognition of primary amine vapors in the solid state at trace level (ppm).

In an effort to circumvent this problem, Cobalt probe 1 (CP1) was designed using a reaction-based strategy to exploit the redox activity of Co2+.

11 Recently, we introduced a new class of PIM prepared using a polymerisation reaction based on the efficient formation of the bridged bicyclic diamine called Tröger's base (TB; i.e., 6H,12H-5,11-methanodibenzo[b,f][1,5]diazocine).

Petroleum generation stages were calculated assuming mainly Type II kerogen and using a reaction kinetic dataset based on Burnham (1989).

To produce a truncated construct for expression of the N-terminal ligand-binding domain, a stop codon was inserted after residue R299 using a polymerase chain reaction based mutagenesis protocol, using oligonucleotide GAGATGAAGCGCTAGGGGAACCCGATC and its reverse-complement.

The plasma nitrite level was assessed using a Griess reaction-based protocol adapted from Giustarini et al. [ 12] and Miranda et al. [ 13].

Experiments for detection of OH●-mediated BSA oxidation were carried out using a metal-catalyzed reaction based on the method described by Kocha et al. [ 31] with modifications.

Experiments for detection of OH●-mediated DNA oxidation were carried out by using a metal-catalyzed reaction based on Kocha et al. [ 31] with modifications.

Anti-CCP and RF levels were determined using enzyme-linked immunosorbent assay, and DRB1 typing was performed using polymerase chain reaction based methodology.

Genotyping for DRB1 alleles was performed using polymerase chain reaction based methods [ 13].

PON-1 192 gene polymorphism was determined using polymerase chain reaction based restriction fragment analysis.