Sentence examples for using a ratio calculation from inspiring English sources

Their expression was compared to that in non-infected control cells (C) using a ratio calculation (NHV/C, L60/C and PrV/C).

In addition to overall general consistency of marker order across individual component maps, good agreement in overall distances between common marker pairs across the component maps used in this study was determined, using a difference ratio calculation.

The clinical significance of the p.A31P cMyBP-C protein mutation was determined by looking at the probability of developing fHCM when comparing the heterozygous and the homozygous mutation carriers with the wild type cats using odds ratio calculation and the 95% confidence interval (95% Cfi) was established.

The number of scenarios to be used with the novices as the 'before' and 'after' training scenarios were calculated using the ratio calculations detailed in the methododological literature on judgement analysis [ 40].

Transcript expression was normalized to a reference ubiquitin transcript (Poptr_0015s01600 in P. trichocarpa genome; 5' GCAGGGAAACAGTGAGGAAGG; 3' TGGACTCACGAGGACAG) using ratio calculation as described in [ 64].

Stratification ratios of C and N fractions and enzymatic activities were responsive to choice of denominator used for ratio calculation.

When the second Mode checkbox is filled in the Relative mode, the Browser automatically colours grey all samples where the values used for the ratio calculation are less than 20 expression units, the background level for the AtGenExpress data sets.

The eCFP emission used for the ratio calculation was determined at 485 nm.

In contrast to qPCR methods in which quantification is based on amplification curve data, our method uses peak height ratio calculations obtained during melting analysisto determine the relative copy number.

This calculation used a hazard ratio of 0.80, with 80% power, α of 0.05, and the probability of survival of 0. This gave sample sizes of 318 in each group, and we rounded this up to 350 in each group.

Attempts to stratify the data in other ways produced no significant results using simple odds-ratio calculations.