The effects of these Cr(V -Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay.
To produce a truncated construct for expression of the N-terminal ligand-binding domain, a stop codon was inserted after residue R299 using a polymerase chain reaction based mutagenesis protocol, using oligonucleotide GAGATGAAGCGCTAGGGGAACCCGATC and its reverse-complement.
Genomic insertion was confirmed using a polymerase chain reaction-based method and Southern blots.
Such assays "are very easy to design," for instance, using a polymerase chain reaction-based strategy, says evolutionary biologist Richard Lenski of Michigan State University in East Lansing; molecular biology labs do it all the time.
Using a polymerase chain reaction-based telomeric repeat amplification protocol (TRAP) assay, we analysed telomerase activity in 99 benign and 45 malignant brain tumours.
Polymorphism of CYP2D6 gene encoding for debrisoquine hydroxylase was determined genotypically for 94 controls and 77 lung cancer patients using a polymerase chain reaction-based application.
Analyses of the mutation spectrum using a polymerase chain reaction-based deletion screening and DNA sequencing procedure showed that a high proportion of HPRT- and GPT- mutants induced by X-rays carry deletion mutations.
We examined the (CTG n repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories) using a polymerase chain reaction-based, single-strand conformational polymorphism analysis.
Donor and host cell chimerism were evaluated using a polymerase chain reaction (PCR) based assay of polymorphic (CA)n dinucleotide repeats with primers specific for informative microsatellite markers.
Donor and host cell chimerism levels were evaluated using a polymerase chain reaction (PCR) based assay of polymorphic (CA)n dinucleotide repeats with primers specific for informative microsatellite markers.
The remaining genes were from a low coverage genome survey of G. diaphanum, G. clarum, and G. cerebriforme using reciprocal BlastX, TBlastX, and TBlastN procedures and by using a polymerase chain reaction (PCR) approach based on degenerate primers.
