Sentence examples for using a pcr fragment from inspiring English sources

Second round of PCR was carried out using a PCR fragment as a template, an Exon5 forward primer (5′TGCTGACATCCTGCTCCTG3′) and an Exon6 reverse primer (5′TGACAATCAGTGCGACCTTGGC3′).

The not4 KanMX6 and bur2 URA3 strains were generated using a PCR fragment from genomic DNA of strain KMY58 and KMY187, respectively.

The plasmids used in this study are described in Table 2. Plasmid pRP1944 was constructed by NsiI digestion of Pab1 in the plasmid pRP1659, and repaired via homologous recombination using a PCR fragment containing the promoter and open reading frame (ORF) for the PBP1 gene.

The Ng081 pilE::PpilE gfpmut3 kan strain was constructed using a PCR fragment that contains fluorescent gene reporter with a selectable drug marker flanked by ends of the target gene.

The amplified fragments were fused yielding the final fragment pilE::gfpmut3 kan, which was used for transformation.> The Ng095 pglF::PpilE gfpmut3 kan strain was constructed using a PCR fragment that contains fluorescent gene reporter with a selectable drug marker flanked by ends of the target gene.

A variation of the above method uses a PCR fragment containing a short direct repeat surrounding URA3 [ 8].

All polymorphisms were investigated using a PCR-restriction fragment length polymorphism technique.

Mutations in the pfcrt (K76T) and pfmdr1 genes were detected using a PCR-restriction fragment length polymorphism (RFLP) method.

Full-length 3′-UTR of IGF2BP2 was cloned into Sac1 and Mlu1 sites of pMIR-REPORT luciferase vector (Ambion, Austin, TX, USA) by using a PCR-generated fragment.

The segregation analysis and the observation of mutations in the control population were performed using a PCR-restriction fragment length polymorphism method.

By using a PCR-based fragment as a template for in vitro transcription, time consuming steps, such as cloning of a target gene and construction of an expression vector were eliminated.