Sentence examples for using a nested primer from inspiring English sources

IS900 MAP DNA was identified using a nested primer PCR in the buffy coat of blood.

Highest amplification rates were achieved using a nested primer set, consisting of primers DINOCOX1F 5'AAAAATTGTAATCATAAACGCTTAGG 3'and DINOCOX1R TGTTGAGCCACCTATAGTAAACATTA described by [52] and then using a nested primer set designed by B. Imanian COX1.DINO.F 5' GAATTTGGAGGTGGCACNGGNTGGACNYT 3' and COX1.DINO.2.R 5'-CCCATCGTATACATRTGRTGNCCCCANAC 3'.

All reactions for tissue samples were subjected to two rounds of amplifications using a nested primer approach.

The poly dC-tailed cDNA products were amplified using a nested primer in exon 2, Exon2R-F4 (5'- ACTCCGTGCCAGGTACAGTTCCATG), and the abridged anchor primer.

PCR product from the previous amplification was diluted 1 200 and 1 μL used as template in a second PCR using a nested primer.

The products of the PCR reaction were diluted 1 100 and the DNA re-amplified using a nested primer and the vector primer SK-long (5'-GCC GCT CTA GAA CTA GTG GAT CCC CCG GGC TGC AGG AGG').

We used a nested primer set designed by Allard et al. (1992) to amplify HAdV.

Since the ATG was missing, a 5' RACE kit (Invitrogen) was used with a nested primer 5' GCCACTGACGACACAGCTTGTAA 3' that yielded the full-length clone.

A second round of PCR was carried out using a nested adapter primer and primers specific for SPL15 (Additional file 5).

For nested-PCR, 1 μL PCR product of the first round of PCR was used as template for the second PCR, making use of a nested primer and the common 3' or 5' primer.

PCR amplification of the resulting cDNA was performed using a nested gene-specific primer (Supplementary file 1B) and a universal 5' primer (Supplementary file 1B) with a touch-down annealing temperature protocol.