Sentence examples for using a negative control from inspiring English sources

No signal was observed using a negative control antibody (normal mouse IgG).

The cut-off value for IgG positivity was determined by using a negative control population of volunteers sampled in Marseille, France in 2008.

In general, all studies reported using a negative control.

Preliminary quantitative PCR assays were performed to evaluate primer pair efficiency and absence of genomic DNA contamination using a negative control.

Percentage of pHrodo-positive neutrophils (phycoerythrin channel) were determined using a negative control (blood incubated with pHrodo Red E. coli BioParticles on ice).

The cutoff for specific competition was determined as >10% by using a negative control rFab D1.3 (a kind gift from Dr. J. Foote, Arrowsmith Technologies, Seattle), specific to an irrelevant target, hen-egg lysozyme, at 5 μg/ml.

Myoglobulin was used a negative control for GR chromatin occupancy: CCTCACATGGGCAGCTATTT (myoglobin forward); GCTTGTGCAAGTCCAGACAG (myoglobulin reverse).

Fluorescence-positive erythrocytes were not observed among erythrocytes used a negative control (Fig. 4a).

DNA from leukaemia Raji cells was used a negative control.

GST was used as a negative control.

PBS was used as a negative control.