Genotyping for the Inpp4awbl mutation was performed using a multiplex PCR reaction with allele specific primers: wtF 5'CTACGGATCCTGGCGCAGA, wtR 5'CTGTCGTAGGCACGTGCTCA, mutF 5'AGTGTCAGGCACTGCTTGGA, mutR 5'GAGGGACGCTCTCTGACATT, resulting in the following bands: wild type, 135 bp; mutant, 277 bp.
Infant genotyping of CCR2-64I and CCR5 promoter polymorphisms were determined using a multiplex ligase detection reaction (LDR) based method with flow cytometric technology, previously described [43], [44].
Genotyping was done using a multiplex polymerase chain reaction (PCR) method.
GSTM1 and GSTT1 genetic polymorphisms were detected simultaneously in a single assay using a multiplex polymerase chain reaction (PCR) approach [ 19].
ETEC, EPEC, and EAEC pathotypes were identified using a multiplex polymerase chain reaction (PCR) previously published [ 7], but adapted for the purpose of GEMS.
Genotypes of HBV were determined by using a multiplex polymerase chain reaction (PCR) assay developed in our laboratory 23 and confirmed by DNA sequencing.
We assessed the relative expression of oestrogen receptor (ER)α and oestrogen receptor (ER)β mRNAs in 36 human endometrial cancers using a multiplex polymerase chain reaction (PCR).
Briefly, some markers from regions containing pseudogenes and close homologs were first preamplified using a multiplex polymerase chain reaction (mPCR) (Qiagen, Valencia, CA, USA).
Genetic identification of enterococci to species level and detection of vanA, vanB, vanC1, or vanC2/C3 and vanD ligase genes were performed by using a multiplex polymerase chain reaction amplification (7 ).
All pneumococcal Quelling-non-typeable strains were reinvestigated for the presence of the most common pneumococcal serotypes using a multiplex polymerase chain reaction (PCR) assay as described previously [ 21].
