Sentence examples for using a multiplex primer from inspiring English sources
PCR was performed using a multiplex primer kit (Invivoscribe Technologies, San Diego, CA) specific for a majority of clonal TCR β chain rearrangements [28].
Compared with DNA genotyping, the AmpliSeq-RNA quantification workflow requires polyA-primed conversion of mRNA to cDNA followed by target specific PCR amplification using a multiplex primer pool.
The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing.
Fragment analysis genotyping was performed using a multiplex of primers, including one standard primer and one M13-tagged primer per marker primer pair, plus one fluorescently-labeled (PET™, NED™, VIC® or 6-FAM™ dye; Applied Biosystems) M13 primer [ 39].
We genotyped 17 mtDNA coding-region single nucleotide polymorphisms (SNPs) using a multiplex single-base primer extension (SNaPshot, Life Technologies) assay as described in Quintans et al. (2004).
Genotyping for the Inpp4awbl mutation was performed using a multiplex PCR reaction with allele specific primers: wtF 5'CTACGGATCCTGGCGCAGA, wtR 5'CTGTCGTAGGCACGTGCTCA, mutF 5'AGTGTCAGGCACTGCTTGGA, mutR 5'GAGGGACGCTCTCTGACATT, resulting in the following bands: wild type, 135 bp; mutant, 277 bp.
The RNA was reverse-transcribed using a MicroRNA Multiplex Primer set and MicroRNA Reverse Transcription kit (Applied Biosystems), cDNA was stored at −20°C.
HPV DNA was amplified with the PGMY09/PGMY11 primer system that uses a multiplex format to amplify both HPV and β-globin in the same tube [ 9].
A combined TY element fingerprint was also obtained by using a four primer multiplex system.
A high-throughput screen of the global miRNA expression was performed using multiplex primer pools (Applied Biosystems) and TaqMan Array Human MicroRNA Panel, Early Access version (P/N 4384792, Applied Biosystems).
The pretreatment bone marrow DNA samples were screened for clonal IgH, IgK and IgL rearrangements using BIOMED-2 multiplex primer sets and heteroduplex analysis on polyacrylamide gels.
