The PCR products were purified using a High Pure PCR product purification kit (Roche Molecular System Inc).
After amplification of the viral RNA, the PCR products were purified using a High Pure PCR Product Purification Kit (Roche Diagnostics, Indianapolis, IN).
PCR products were purified by using a High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany).
Amplification products were checked by electrophoresis, then purified using a High Pure PCR Product purification kit (Roche Molecular Biochemicals, Indianapolis, IN).
PCR amplicons were purified using a High Pure PCR Product Purification Kit (Roche, Basel, Switzerland), then analyzed with a bioanalyzer (Agilent Technologies).
Upon amplification, PCR products were detected on a 2 % Ethidium bromide agarose gel and visualised under an UV transilluminator and purified, using a High Pure PCR product purification kit (Roche, New South Wales, Australia).
To that end DNA was extracted first from the remainder of the CytoRich sample using a High Pure PCR product Purification Kit according to the manufacturer's recommendations (Roche Applied Science, Mannheim, Germany).
The amplified PCR products were tested for the presence of a single PCR product using a high resolution disassociation curve with temperature increasing in 0.2°C increments at the end of each PCR run.
cDNA synthesis was carried out using a high capacity cDNA archive kit (Applied Biosystems, Product Number 4322171) according to the manufacturer's protocols.
Forward 5' TGCATCTGCCTCCCCATATT 3' Reverse 5' AGTGGGCGGGCAATGTAG Probe CTCGGACACCACACCCTGCTGCTGCTGCT 3' For quantification of mRNAs by LDA, cDNA was synthesised from RNA obtained from liver, tonsil and thrombin-treated aortic endothelial cells using a high capacity cDNA archive kit (Applied Biosystems, Product Number 4322171) according to the manufacturer's protocols.
Achieving high fractionation yields and maintaining the integrity of the macromolecular fractionation products without using a high quantity of chemicals and without generating wastewater are of major importance, regarding the effectiveness of the refining process.
