Sentence examples for using a genomic template from inspiring English sources

Exact(1)

In this article, we present an improved OE PCR method that can be used for the generation of large DNA fragments (up to 7.4 kb) where at least 13 changes can be introduced using a genomic template.

Similar(59)

PCRs were performed using a genomic DNA template with a final concentration of 1.2 ng/μl in each PCR reaction volume.

Most recently, using a genomic DNA template and tiling bacterial artificial chromosome (BAC) microarray, copy number alterations can be identified at the submegabase level [ 36].

To clone the gene coding for Pythium ∆-desaturase (PyDes6), a portion of gene was amplified by PCR using a genomic DNA template and degenerate primers, P14-PyDes6-F and P15-PyDes6-R (Table  3), which were designed based on conserved amino acid sequences of ∆-desaturases of several fungi, F(W/Y QQSGWLAH and (Q/N YQ(I/V)(E/D HHLFP, respectively.

To construct expression plasmids of cat1+ and its point mutants, cat1+ ORF amplified by PCR using a genomic library (NBRP) as a template was cloned into pREP273-EGFP, which was generated by the replacement of multi-cloning sites together with the nmt41 promoter (Basi et al., 1993) and 3HA fragment from pSLF273 (NBRP) and the insertion of EGFP ORF in NotI and BglII sites.

To validate 4,967 EST-SSR markers, we chose a sample of 20 primers randomly from this collection to assess their functionality and ability to detect polymorphism using a template of genomic DNAs isolated from twelve date palm cultivars.

Gene-specific primers Ba_TPI_207U (TTCGGCTGAGATGATAAAGG) and Ba_TPI_473L (AGTACCAATGGCCCACACTG) were designed within the Tpi sequence to amplify an intronic region, using the same genomic template as for the AFLP reactions.

Since only a few of the targeted biothreat agents can be obtained and processed in a BSL2 laboratory, efforts using natural genomic templates to demonstrate LOD for a majority of the targets on RPM-TEI chip were constrained.

Oligonucleotide primers were designed to amplify 500-800 bp regions using genomic template.

The amphioxus amphiVent1, amphiVent2, amphiGoosecoid, amphiChordin, xenopus XVent2b and human VENTX2 promoters were amplified by PCR using a corresponding genomic DNA as a template.

Retrospective testing of some targets using genomic templates demonstrated concordant results to those observed using synthetic templates.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: