Sentence examples for using a different reference from inspiring English sources

Then this is applied to the holographic memory, which contains transformed target images, each written into the memory using a different reference beam.

Boelaert 2008 - Ethiopia re-analysed the same patient population data as Diro 2007, but using a different reference standard.

If some patients received verification using a different reference standard this item should be scored as "no".

The adult measures were converted to Z-scores using a different reference than the child measures, as growth standards are not yet available.

Contrasts of the correlates of the above-mentioned dependent variables were tested by repeating the logistic regression analyses using a different reference group for each categorical independent variable each time.

By using a regression-analysis model of the published literature, Lijmer et al. [ 7] showed that inclusion of a diseased population in meta-analyses of diagnostic tests overestimates the diagnostic odds ratio (DOR) by threefold and that using a different reference standard in those studies overestimates the DOR by at least twofold.

First, the mixed spatial-resolution frames should use a different reference frame selection.

Moreover, both studies used a different reference animal and the reference animal was also from the same breed.

This was the only paper in our analysis that was found to use a different reference sequence numbering for the mutations, preventing a direct match to the information in the database.

Multiple plants regenerated from each selected transgenic line of calli were analysed for relative copy number according to the methods described by Basnayake et al. 2011 [ 18], with the exception of using a different GAPDH reference gene 3' primer (GAPDHrevb ACGGGATCTCCTCAGGGTTC).

We first aligned the 1a and 1b sequences and generated a neighbor-joining tree, using a different subtype consensus reference as an out-group.