Sentence examples for using a cdna template from inspiring English sources

The fragments were obtained by PCR reaction using a cDNA template and the primers designed specifically for the amplification of each fragment are shown in the Table 1.

RT-PCR was performed to amplify genes using a cDNA template corresponding to gene-specific primer sets.

This RNA was joined to the central portion of P2−P3 with the 27 nt sequence 5′-GCACGCAAGUUUCUACCGGGCACCGUA-3′ using a cDNA template and T4 DNA ligase.

In a preliminary study, we performed similar PCR using a cDNA template isolated from a hepatoma tissue of a patient with autoimmune hepatitis.

The following two primers HR3A, 5'-DAT YTT NCC YTT RTA YTT RAA RTC-3' (forward), and HR5A, 5'-GGN TTY CCN ATD CCN GAY CC-3' (reverse) (MGW Biotech)–were then used for PCRs using a cDNA template.

Antisense and sense IFN-α cDNAs were synthesized by a standard PCR protocol (Invitrogen Platinum Taq) using a cDNA template from a rat liver sample of acute liver injury (24 h after CCl4 ingestion).

After the RT reaction, 2- μL aliquots were used as a cDNA template for polymerase chain reaction (PCR) amplifications using GoTaq DNA Polymerase (Promega, Madison, WI, USA).

The forward primer (5'tccctcccggcctttcctccta3') and the reverse primer (5'ccggagacacctggggagatgatc3') generated a 650 bp product, which was used as a cDNA template for a second set of Id2 primers producing a 434-bp product.

Figure 5b shows the result of the PCR reactions using cercariae as a cDNA template.

Reactions were carried out in triplicates according to manufacturer instructions using a 20 ng cDNA template for each reaction.

Isolation of these putative orthologues in wheat was carried out through direct sequencing of RT-PCR products using cDNA template derived from a mixed tissue sample containing several stages of developing leaves, spikes, carpels and seeds.